Please activate JavaScript!
Please install Adobe Flash Player, click here for download
ePaper created 2016-06-09, 15:16:05 | version 1.38.0
Journal of Oral Science & Rehabilitation 28 Volume 2 | Issue 2/2016 H u m a n i n d u c e d p l u r i p o t e n t s t e m c e l l s f r o m h u m a n o r a l m u c o s a Switzerland) according to the manufacturer’s instructions using program DT-130 (Lonza). These cells were then transferred on to mitomy- cin C-treated SNL76/7 cells (cat. No. 07032801, lot No. 08F009; European Collection ofAuthen- ticated Cell Cultures, Porton Down, U.K.) at 5 × 104 cells per100mm dish.Thefollowing day, the culture medium was replaced with embry- onic stem cell (ESC) culture medium consisting of DMEM/F12 medium (Sigma-Aldrich, St. Louis,Mo.,U.S.)supplementedwith20%Knock- Out Serum Replacement (Gibco, Grand Island, N.Y., U.S.), 2mM L-glutamine (Nacalai Tesque, Kyoto,Japan), 1% nonessentialamino acids (Gib- co), 0.1mM 2-mercaptoethanol(Gibco) and 5ng/ mL fibroblast growth factor-2 (ReproCELL, Kanagawa, Japan). Thirty days subsequent to transduction,anumberofcoloniesweremechan- ically picked and transferred to a 24-well plate. After several passages, ESC-like colonies were selectedforfurthercultivation and characteriza- tion. IPSCs were generated and maintained in ESCculturemedium.Forroutinepassaging,iPSC colonies were detached with CTK solution (2.5μg/mLtrypsin, 1mg/mLcollagenase IV, 20% KSR, 1 mM CaCl2/PBS, and 70% PBS) and split at a 1:3 ratio every four to five days. Q u a n t i t a t i v e r e a l - t i m e r e v e r s e t r a n s c r i p t i o n - p o l y m e r a s e c h a i n r e a c t i o n Total RNA was isolated using the RNeasy Micro Kit (Qiagen, Limburg, Netherlands) according to the manufacturer’s protocol. Single-stranded complementary DNA was synthesized from a total of 500ng RNA (DNase-treated) using the PrimeScript RT Master Mix (Takara, Shiga, Japan). KhES-1 RNA was provided by the Foun- dation for Biomedical Research and Innovation (Kobe, Japan). Quantitative real-time reverse transcription-polymerase chain reaction (qRT- PCR) was conducted in triplicate using SYBR Select Master Mix (Life Technologies, Grand Island,N.Y.,U.S.)withaStepOnePlussystem(Life Technologies) and the following PCR program: 95°C for 10min, then 40 cycles of 95°C for 15s, 60°Cfor1minand72°Cfor15s.Specificprimers are listed in Table 1. The glyceraldehyde-3- phosphate dehydrogenase (GAPDH) gene was co-amplified as an internal standard. Gene ex- pressionwasmeasuredusingtheΔΔCT method.20 Differences in gene expression between KhES-1, HOF-iPSCsandHOFswereevaluatedbyvariance analysis with the Tukey test. Table 1 List of primers used for qRT-PCR. Table 1 Primer Gene Sequences (5’ to 3’) Pluripotent marker OCT3/4 Forward GAAACCCACACTGCAGCAGA Reverse TCGCTTGCCCTTCTGGCG NANOG Forward CTCAGCTACAAACAGGTGAAGAC Reverse TCCCTGGTGGTAGGAAGAGTAAA SOX2 Forward GGGAAATGGGAGGGGTGCAAAAGAGG Reverse TTGCGTGAGTGTGGATGGGATTGGTG KLF4 Forward CGCTCCATTACCAAGAGCTCAT Reverse CGATCGTCTTCCCCTCTTTG TERT Forward CGTACAGGTTTCACGCATGTG Reverse ATGACGCGCAGGAAAAATGT C-MYC Forward GTTGGTCAGGCTGGTCTTGAA Reverse CATGCGCCTGTAATCCTAGCA Internal control GAPDH Forward CCACTCCTCCACCTTTGACG Reverse ATGAGGTCCACCACCCTGTT